hek 293 t cells (Procell Inc)

About

News

Press Release

Team

Advisors

Partners

Contact

Bioz Stars

Bioz vStars

Buy from Supplier

Structured Review

Procell Inc hek 293 t cells
Hek 293 T Cells, supplied by Procell Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/hek+293+t+cells/cells+hek293t/pm42119168-282-3-9
Average 86 stars, based on 1 article reviews

hek 293 t cells - by Bioz Stars, 2026-09

86/100 stars

Images

Cell Culture:

Article Title: Multi-omics revealed GOT1/ALDH3A1 pathway attenuated head and neck squamous cell carcinoma and increased cisplatin sensitivity through ROS induced by mitochondrial dysfunction
Article Snippet: .. HEK-293 T cells (human embryonic kidney cells) were purchased from ProCell (Wuhan, China) and cultured in DMEM with 10%(v/v) FBS until 80% confluence was reached. .. The target plasmid was obtained from Tsingke Biotech (Beijing, China), and the sequences are provided in Supplementary Table S1.

Article Title: From clinical exosome analysis to engineered therapy: miR-21-5p-Enriched exosomes reverse thin endometrium via the YAP1 pathway.
Article Snippet: Thin endometrium (TE) is associated with reduced pregnancy rates and adverse obstetric outcomes.. While current interventions including hysteroscopic adhesiolysis and hormonal regimens offer partial solutions, functional restoration remains challenging due to the elusive pathogenesis of TE.. This work systematically decodes the miRNA landscape of uterine fluid-derived exosomes (UF-Exo) between TE patients and healthy women, uncovering a dramatic downregulation of miR-21-5p (74.0%) and miR-548aa (64.5%) in TE-derived UF-Exo that critically underpins disease progression.

Article Title: Multi-omics revealed GOT1/ALDH3A1 pathway attenuated head and neck squamous cell carcinoma and increased cisplatin sensitivity through ROS induced by mitochondrial dysfunction.
Article Snippet: .. HEK-293 T cells (human embryonic kidney cells) were purchased from ProCell (Wuhan, China) and cultured in DMEM with 10%(v/v) FBS until 80% confluence was reached. .. The target plasmid was obtained from Tsingke Biotech (Beijing, China), and the sequences are provided in Supplementary Table S1.

Modification:

Article Title: Circadian Clock Dysfunction Exacerbate Autistic‐Like Behaviour and Wnt/β‐Catenin Signalling Dysregulation in ASD Mice and Treatment of Melatonin
Article Snippet: .. HEK‐293 T cells and mouse hippocampal HT22 cells were obtained from Proceell (Procell, Wuhan, China); both HEK‐293 T and HT22 were maintained in Dulbecco's Modified Eagle Medium (DMEM) (Procell, Wuhan, China) supplemented with 10% fetal bovine serum (Gibco, Carlsbad, CA, USA) at 37°C in a 5% CO2 humidified incubator. ..

Incubation:

Article Title: miR-19a-3p downregulates tissue factor and functions as a potential therapeutic target for sepsis-induced disseminated intravascular coagulation.
Article Snippet: The WT and MUT recombinant plasmid vectors (Promega, Madison, WI, USA) were confirmed by HindIII-Hpal double enzyme digestion and Sanger sequencing (Promega, Madison, WI, USA). .. HEK 293 T cells (Procell Life Science & Technology Co. Ltd, Wuhan, China) (5 × 104 cells/well) were seeded in a 96-well plate, incubated overnight, and cotransfected with miR-19a-3p mimics (UGUGCAAAUCUAUGCAAAACUGA, GenePharma, Shanghai, China). .. Luciferase reporter vectors (pGL3 control, pGL3control-TF19a-WT, and pGL3-control-TF19a-MUT) were established by Lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA) transfection according to the manufacturer’s recommended protocols.

Luciferase:

Article Title: LncRNA H19/miR-107 regulates endothelial progenitor cell pyroptosis and promotes flow recovery of lower extremity ischemia through targeting FADD.
Article Snippet: .. HEK 293 T cells purchased from Procell Life Science&Technology were used for luciferase reporter assay. ..

Review

hek 293 t cells (Procell Inc)

Structured Review

Images

Related Articles

Cell Culture:

Modification:

Incubation:

Luciferase:

Reporter Assay:

Similar Products

Image Search Results